Provided by: vienna-rna_2.5.1+dfsg-1build3_amd64 
NAME
RNAfold - manual page for RNAfold 2.5.1
SYNOPSIS
RNAfold [OPTIONS] [<input0.fa>] [<input1.fa>]...
DESCRIPTION
RNAfold 2.5.1
Calculate minimum free energy secondary structures and partition function of RNAs
The program reads RNA sequences, calculates their minimum free energy (mfe) structure and prints the mfe
structure in bracket notation and its free energy. If not specified differently using commandline
arguments, input is accepted from stdin or read from an input file, and output printed to stdout. If the
-p option was given it also computes the partition function (pf) and base pairing probability matrix, and
prints the free energy of the thermodynamic ensemble, the frequency of the mfe structure in the ensemble,
and the ensemble diversity to stdout.
It also produces PostScript files with plots of the resulting secondary structure graph and a "dot plot"
of the base pairing matrix. The dot plot shows a matrix of squares with area proportional to the pairing
probability in the upper right half, and one square for each pair in the minimum free energy structure in
the lower left half. For each pair i-j with probability p>10E-6 there is a line of the form
i j sqrt(p) ubox
in the PostScript file, so that the pair probabilities can be easily extracted.
Sequences may be provided in a simple text format where each sequence occupies a single line. Output
files are named "rna.ps" and "dot.ps". Existing files of the same name will be overwritten.
It is also possible to provide sequence data in FASTA format. In this case, the first word of the FASTA
header will be used as prefix for output file names. PostScript files "prefix_ss.ps" and "prefix_dp.ps"
are produced for the structure and dot plot, respectively. Note, however, that once FASTA input was
provided all following sequences must be in FASTA format too.
To avoid problems with certain operating systems and/or file systems the prefix will ALWAYS be sanitized!
This step substitutes any special character in the prefix by a filename delimiter. See the
--filename-delim option to change the delimiting character according to your requirements.
The program will continue to read new sequences until a line consisting of the single character @ or an
end of file (EOF) condition is encountered.
-h, --help
Print help and exit
--detailed-help
Print help, including all details and hidden options, and exit
--full-help
Print help, including hidden options, and exit
-V, --version
Print version and exit
General Options:
Command line options which alter the general behavior of this program
-v, --verbose
Be verbose.
(default=off)
-j, --jobs[=number]
Split batch input into jobs and start processing in parallel using multiple threads. A value of 0
indicates to use as many parallel threads as computation cores are available.
(default=`0')
Default processing of input data is performed in a serial fashion, i.e. one sequence at a time.
Using this switch, a user can instead start the computation for many sequences in the input in
parallel. RNAfold will create as many parallel computation slots as specified and assigns input
sequences of the input file(s) to the available slots. Note, that this increases memory
consumption since input alignments have to be kept in memory until an empty compute slot is
available and each running job requires its own dynamic programming matrices.
--unordered
Do not try to keep output in order with input while parallel processing is in place.
(default=off)
When parallel input processing (--jobs flag) is enabled, the order in which input is processed
depends on the host machines job scheduler. Therefore, any output to stdout or files generated by
this program will most likely not follow the order of the corresponding input data set. The
default of RNAfold is to use a specialized data structure to still keep the results output in
order with the input data. However, this comes with a trade-off in terms of memory consumption,
since all output must be kept in memory for as long as no chunks of consecutive, ordered output
are available. By setting this flag, RNAfold will not buffer individual results but print them as
soon as they have been computated.
-i, --infile=<filename>
Read a file instead of reading from stdin
The default behavior of RNAfold is to read input from stdin or the file(s) that follow(s) the
RNAfold command. Using this parameter the user can specify input file names where data is read
from. Note, that any additional files supplied to RNAfold are still processed as well.
-o, --outfile[=<filename>]
Print output to file instead of stdout
This option may be used to write all output to output files rather than printing to stdout. The
default filename is "RNAfold_output.fold" if no FASTA header precedes the input sequences and the
--auto-id feature is inactive. Otherwise, output files with the scheme "prefix.fold" are
generated, where the "prefix" is taken from the sequence id, e.g. the FASTA header. The user may
specify a single output file name for all data generated from the input by supplying a filename as
argument following immediately after this parameter. In case a file with the same filename
already exists, any output of the program will be appended to it. Note: Any special characters in
the filename will be replaced by the filename delimiter, hence there is no way to pass an entire
directory path through this option (yet). (See also the "--filename-delim" parameter)
-t, --layout-type=INT
Choose the layout algorithm. (default=`1')
Select the layout algorithm that computes the nucleotide coordinates. Currently, the following
algorithms are available:
0: simple radial layout
1: Naview layout (Bruccoleri et al. 1988)
2: circular layout
3: RNAturtle (Wiegreffe et al. 2018)
4: RNApuzzler (Wiegreffe et al. 2018)
--noPS Do not produce postscript drawing of the mfe structure.
(default=off)
--noDP Do not produce dot-plot postscript file containing base pair or stack probabilitities.
(default=off)
In combination with the -p option, this flag turns-off creation of individual dot-plot files.
Consequently, computed base pair probability output is omitted but centroid and MEA structure
prediction is still performed.
--noconv
Do not automatically substitute nucleotide "T" with "U"
(default=off)
--auto-id
Automatically generate an ID for each sequence. (default=off)
The default mode of RNAfold is to automatically determine an ID from the input sequence data if
the input file format allows to do that. Sequence IDs are usually given in the FASTA header of
input sequences. If this flag is active, RNAfold ignores any IDs retrieved from the input and
automatically generates an ID for each sequence. This ID consists of a prefix and an increasing
number. This flag can also be used to add a FASTA header to the output even if the input has none.
--id-prefix=prefix
Prefix for automatically generated IDs (as used in output file names)
(default=`sequence')
If this parameter is set, each sequence will be prefixed with the provided string. Hence, the
output files will obey the following naming scheme: "prefix_xxxx_ss.ps" (secondary structure
plot), "prefix_xxxx_dp.ps" (dot-plot), "prefix_xxxx_dp2.ps" (stack probabilities), etc. where xxxx
is the sequence number. Note: Setting this parameter implies --auto-id.
--id-delim=delimiter
Change the delimiter between prefix and increasing number for automatically generated IDs (as used
in output file names)
(default=`_')
This parameter can be used to change the default delimiter "_" between
the prefix string and the increasing number for automatically generated ID.
--id-digits=INT
Specify the number of digits of the counter in automatically generated alignment IDs.
(default=`4')
When alignments IDs are automatically generated, they receive an increasing number, starting with
1. This number will always be left-padded by leading zeros, such that the number takes up a
certain width. Using this parameter, the width can be specified to the users need. We allow
numbers in the range [1:18]. This option implies --auto-id.
--id-start=LONG
Specify the first number in automatically generated alignment IDs.
(default=`1')
When sequence IDs are automatically generated, they receive an increasing number, usually starting
with 1. Using this parameter, the first number can be specified to the users requirements. Note:
negative numbers are not allowed. Note: Setting this parameter implies to ignore any IDs
retrieved from the input data, i.e. it activates the --auto-id flag.
--filename-delim=delimiter
Change the delimiting character that is used
for sanitized filenames
(default=`ID-delimiter')
This parameter can be used to change the delimiting character used while sanitizing filenames,
i.e. replacing invalid characters. Note, that the default delimiter ALWAYS is the first character
of the "ID delimiter" as supplied through the --id-delim option. If the delimiter is a whitespace
character or empty, invalid characters will be simply removed rather than substituted. Currently,
we regard the following characters as illegal for use in filenames: backslash '\', slash '/',
question mark '?', percent sign '%', asterisk '*', colon ':', pipe symbol '|', double quote '"',
triangular brackets '<' and '>'.
--filename-full
Use full FASTA header to create filenames
(default=off)
This parameter can be used to deactivate the default behavior of limiting output filenames to the
first word of the sequence ID. Consider the following example: An input with FASTA header
">NM_0001 Homo Sapiens some gene" usually produces output files with the prefix "NM_0001" without
the additional data available in the FASTA header, e.g. "NM_0001_ss.ps" for secondary structure
plots. With this flag set, no truncation of the output filenames is done, i.e. output filenames
receive the full FASTA header data as prefixes. Note, however, that invalid characters (such as
whitespace) will be substituted by a delimiting character or simply removed, (see also the
parameter option --filename-delim).
Structure Constraints:
Command line options to interact with the structure constraints feature of this program
--maxBPspan=INT
Set the maximum base pair span
(default=`-1')
-C, --constraint[=<filename>] Calculate structures subject to constraints.
(default=`')
The program reads first the sequence, then a string containing constraints on the structure
encoded with the symbols:
. (no constraint for this base)
| (the corresponding base has to be paired
x (the base is unpaired)
< (base i is paired with a base j>i)
> (base i is paired with a base j<i)
and matching brackets ( ) (base i pairs base j)
With the exception of "|", constraints will disallow all pairs conflicting with the constraint.
This is usually sufficient to enforce the constraint, but occasionally a base may stay unpaired in
spite of constraints. PF folding ignores constraints of type "|".
--batch
Use constraints for multiple sequences. (default=off)
Usually, constraints provided from input file only apply to a single input sequence. Therefore,
RNAfold will stop its computation and quit after the first input sequence was processed. Using
this switch, RNAfold processes multiple input sequences and applies the same provided constraints
to each of them.
--canonicalBPonly
Remove non-canonical base pairs from the structure constraint
(default=off)
--enforceConstraint
Enforce base pairs given by round brackets ( ) in structure constraint
(default=off)
--shape=<filename>
Use SHAPE reactivity data to guide structure predictions
--shapeMethod=D|Z|W
Select SHAPE reactivity data incorporation strategy.
(default=`D')
The following methods can be used to convert SHAPE reactivities into pseudo energy contributions.
'D': Convert by using a linear equation according to Deigan et al 2009.
Derived pseudo energy terms will be applied for every nucleotide involved in a stacked pair. This
method is recognized by a capital 'D' in the provided parameter, i.e.: --shapeMethod="D" is the
default setting. The slope 'm' and the intercept 'b' can be set to a non-default value if
necessary, otherwise m=1.8 and b=-0.6. To alter these parameters, e.g. m=1.9 and b=-0.7, use a
parameter string like this: --shapeMethod="Dm1.9b-0.7". You may also provide only one of the two
parameters like: --shapeMethod="Dm1.9" or --shapeMethod="Db-0.7".
'Z': Convert SHAPE reactivities to pseudo energies according to Zarringhalam
et al 2012. SHAPE reactivities will be converted to pairing probabilities by using linear mapping.
Aberration from the observed pairing probabilities will be penalized during the folding recursion.
The magnitude of the penalties can affected by adjusting the factor beta (e.g.
--shapeMethod="Zb0.8").
'W': Apply a given vector of perturbation energies to unpaired nucleotides
according to Washietl et al 2012. Perturbation vectors can be calculated by using RNApvmin.
--shapeConversion=M|C|S|L|O
Select method to convert SHAPE reactivities to
pairing probabilities.
(default=`O')
This parameter is useful when dealing with the SHAPE incorporation according to Zarringhalam et
al. The following methods can be used to convert SHAPE reactivities into the probability for a
certain nucleotide to be unpaired.
'M': Use linear mapping according to Zarringhalam et al. 'C': Use a cutoff-approach to divide
into paired and unpaired nucleotides (e.g. "C0.25") 'S': Skip the normalizing step since the input
data already represents probabilities for being unpaired rather than raw reactivity values 'L':
Use a linear model to convert the reactivity into a probability for being unpaired (e.g.
"Ls0.68i0.2" to use a slope of 0.68 and an intercept of 0.2) 'O': Use a linear model to convert
the log of the reactivity into a probability for being unpaired (e.g. "Os1.6i-2.29" to use a slope
of 1.6 and an intercept of -2.29)
--motif=SEQUENCE,STRUCTURE,ENERGY
Specify stabilizing effect of ligand binding to
a particular sequence/structure motif.
Some ligands binding to RNAs require and/or induce particular sequence and structure motifs. For
instance they bind to an interior loop, or small hairpin loop. If for such cases a binding free
energy is known, the binding and therefore stabilizing effect of the ligand can be included in the
folding recursions. Interior loop motifs are specified as concatenations of 5' and 3' motif,
separated by an '&' character.
Energy contributions must be specified in kcal/mol.
See the manpage for an example usage of this option.
--commands=<filename>
Read additional commands from file
Commands include hard and soft constraints, but also structure motifs in hairpin and interior
loops that need to be treeted differently. Furthermore, commands can be set for unstructured and
structured domains.
Algorithms:
Select additional algorithms which should be included in the calculations. The Minimum free
energy (MFE) and a structure representative are calculated in any case.
-p, --partfunc[=INT]
Calculate the partition function and base pairing probability matrix.
(default=`1')
In addition to the MFE structure we print a coarse representation of the pair probabilities in
form of a pseudo bracket notation followed by the ensemble free energy. This notation makes use of
the letters " . , | { } ( ) " denoting bases that are essentially unpaired, weakly paired,
strongly paired without preference, weakly upstream (downstream) paired, or strongly up-
(down-)stream paired bases, respectively. On the next line the centroid structure as derived from
the pair probabilities together with its free energy and distance to the ensemble is shown.
Finally it prints the frequency of the mfe structure, and the structural diversity (mean distance
between the structures in the ensemble). See the description of pf_fold() and mean_bp_dist() and
centroid() in the RNAlib documentation for details. Note that unless you also specify -d2 or -d0,
the partition function and mfe calculations will use a slightly different energy model. See the
discussion of dangling end options below.
An additionally passed value to this option changes the behavior of partition function
calculation: -p0 Calculate the partition function but not the pair probabilities, saving about 50%
in runtime. This prints the ensemble free energy -kT ln(Z). -p2 Compute stack probabilities, i.e.
the probability that a pair (i,j) and the immediately interior pair (i+1,j-1) are formed
simultaneously in addition to pair probabilities. A second postscript dot plot called
"name_dp2.ps", or "dot2.ps" (if the sequence does not have a name), is produced that contains pair
probabilities in the upper right half and stack probabilities in the lower left.
--MEA[=gamma]
Calculate an MEA (maximum expected accuracy) structure, where the expected accuracy is computed
from the pair probabilities: each base pair (i,j) gets a score 2*gamma*p_ij and the score of an
unpaired base is given by the probability of not forming a pair.
(default=`1.')
The parameter gamma tunes the importance of correctly predicted pairs versus unpaired bases. Thus,
for small values of gamma the MEA structure will contain only pairs with very high probability.
Using --MEA implies -p for computing the pair probabilities.
-S, --pfScale=scaling factor
In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to
avoid overflows).
The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences. You
can also recompile the program to use double precision (see the README file).
-c, --circ
Assume a circular (instead of linear) RNA molecule.
(default=off)
--ImFeelingLucky
Return exactly one stochastically backtracked structure
(default=off)
This function computes the partition function and returns exactly one secondary structure
stochastically sampled from the Boltzmann equilibrium according to its probability in the ensemble
--bppmThreshold=<value>
Set the threshold for base pair probabilities included in the postscript output
(default=`1e-5')
By setting the threshold the base pair probabilities that are included in the output can be
varied. By default only those exceeding 1e-5 in probability will be shown as squares in the dot
plot. Changing the threshold to any other value allows for increase or decrease of data.
-g, --gquad
Incoorporate G-Quadruplex formation into the structure prediction algorithm.
(default=off)
Model Details:
-T, --temp=DOUBLE
Rescale energy parameters to a temperature of temp C. Default is 37C.
-4, --noTetra
Do not include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins.
(default=off)
Mostly for testing.
-d, --dangles=INT
How to treat "dangling end" energies for bases adjacent to helices in free ends and multi-loops
(default=`2')
With -d1 only unpaired bases can participate in at most one dangling end. With -d2 this check is
ignored, dangling energies will be added for the bases adjacent to a helix on both sides in any
case; this is the default for mfe and partition function folding (-p). The option -d0 ignores
dangling ends altogether (mostly for debugging). With -d3 mfe folding will allow coaxial stacking
of adjacent helices in multi-loops. At the moment the implementation will not allow coaxial
stacking of the two interior pairs in a loop of degree 3 and works only for mfe folding.
Note that with -d1 and -d3 only the MFE computations will be using this setting while partition
function uses -d2 setting, i.e. dangling ends will be treated differently.
--noLP Produce structures without lonely pairs (helices of length 1).
(default=off)
For partition function folding this only disallows pairs that can only occur isolated. Other pairs
may still occasionally occur as helices of length 1.
--noGU Do not allow GU pairs
(default=off)
--noClosingGU
Do not allow GU pairs at the end of helices
(default=off)
-P, --paramFile=paramfile
Read energy parameters from paramfile, instead of using the default parameter set.
Different sets of energy parameters for RNA and DNA should accompany your distribution. See the
RNAlib documentation for details on the file format. When passing the placeholder file name "DNA",
DNA parameters are loaded without the need to actually specify any input file.
--nsp=STRING
Allow other pairs in addition to the usual AU,GC,and GU pairs.
Its argument is a comma separated list of additionally allowed pairs. If the first character is a
"-" then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA will allow GA and
AG pairs. Nonstandard pairs are given 0 stacking energy.
-e, --energyModel=INT
Rarely used option to fold sequences from the artificial ABCD... alphabet, where A pairs B, C-D
etc. Use the energy parameters for GC (-e 1) or AU (-e 2) pairs.
--betaScale=DOUBLE
Set the scaling of the Boltzmann factors (default=`1.')
The argument provided with this option enables to scale the thermodynamic temperature used in the
Boltzmann factors independently from the temperature used to scale the individual energy
contributions of the loop types. The Boltzmann factors then become exp(-dG/(kT*betaScale)) where k
is the Boltzmann constant, dG the free energy contribution of the state and T the absolute
temperature.
REFERENCES
If you use this program in your work you might want to cite:
R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and I.L. Hofacker
(2011), "ViennaRNA Package 2.0", Algorithms for Molecular Biology: 6:26
I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994), "Fast Folding and
Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, pp 167-188
R. Lorenz, I.L. Hofacker, P.F. Stadler (2016), "RNA folding with hard and soft constraints", Algorithms
for Molecular Biology 11:1 pp 1-13
M. Zuker, P. Stiegler (1981), "Optimal computer folding of large RNA sequences using thermodynamic and
auxiliary information", Nucl Acid Res: 9, pp 133-148
J.S. McCaskill (1990), "The equilibrium partition function and base pair binding probabilities for RNA
secondary structures", Biopolymers: 29, pp 1105-1119
I.L. Hofacker & P.F. Stadler (2006), "Memory Efficient Folding Algorithms for Circular RNA Secondary
Structures", Bioinformatics
A.F. Bompfuenewerer, R. Backofen, S.H. Bernhart, J. Hertel, I.L. Hofacker, P.F. Stadler, S. Will (2007),
"Variations on {RNA} Folding and Alignment: Lessons from Benasque", J. Math. Biol.
D. Adams (1979), "The hitchhiker's guide to the galaxy", Pan Books, London
The calculation of mfe structures is based on dynamic programming algorithm originally developed by M.
Zuker and P. Stiegler. The partition function algorithm is based on work by J.S. McCaskill.
The energy parameters are taken from:
D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J. Susan, M. Zuker, D.H. Turner
(2004), "Incorporating chemical modification constraints into a dynamic programming algorithm for
prediction of RNA secondary structure", Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292
D.H Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor parameter database for predicting stability
of nucleic acid secondary structure", Nucleic Acids Research: 38, pp 280-282
EXAMPLES
Single line sequence input and calculation of partition function and MEA structure
$ RNAfold --MEA -d2 -p
The program will then prompt for sequence input. Using the example sequence "CGACGTAGATGCTAGCTGACTCGATGC"
and pressing ENTER the output of the program will be similar to
CGACGUAGAUGCUAGCUGACUCGAUGC
(((.((((.......)).)))))....
minimum free energy = -1.90 kcal/mol
(((.((((.......))},})))....
free energy of ensemble = -2.86 kcal/mol
(((.(.((.......))..)))).... { 0.80 d=2.81}
(((.((((.......))).)))).... { -1.90 MEA=22.32}
frequency of mfe structure in ensemble 0.20997; ensemble diversity 4.19
Here, the first line just repeats the sequence input. The second line contains a MFE structure in dot
bracket notation followed by the minimum free energy. After this, the pairing probabilities for each
nucleotide are shown in a pseudo dot-bracket notation followed by the free energy of ensemble. The next
two lines show the centroid structure with its free energy and its distance to the ensemble as well as
the MEA structure, its free energy and the maximum expected accuracy, respectively. The last line finally
contains the frequency of the MFE representative in the complete ensemble of secondary structures and the
ensemble diversity. For further details about the calculation and interpretation of the given output
refer to the reference manual of RNAlib.
Since version 2.0 it is also possible to provide FASTA file sequence input. Assume you have a file
containing two sequences in FASTA format, e.g
$ cat sequences.fa
>seq1
CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
GAACGAUCUAUAACACGACUUCACUCUU
>seq2
GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUA
UAACACGACUUCACUCUU
In order to compute the MFE for the two sequences the user can use the following command
$ RNAfold < sequences.fa
which would result in an output like this
>seq1
CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
.((.(((...((((..(((((........)))))))))...))).))................... ( -5.40)
>seq2
GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
.......((((..............))))........................... ( -2.00)
CONSTRAINT EXAMPLES
Secondary structure constraints may be given in addition to the sequence information, too. Using the
first sequence of the previous example and restricting the nucleotides of the outermost helix to be
unpaired, i.e. base pairs (2,47) and (3,46) the input file should have the following form
$ cat sequence_unpaired.fa
>seq1
CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
GAACGAUCUAUAACACGACUUCACUCUU
.xx...................................
.......xx...................
Calling RNAfold with the structure constraint option -C it shows the following result
$ RNAfold -C < sequence_unpaired.fa
>seq1
CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
....(((...((((..(((((........)))))))))...)))...................... ( -4.20)
This represents the minimum free energy and a structure representative of the RNA sequence given that
nucleotides 2,3,46 and 47 must not be involved in any base pair. For further information about
constrained folding refer to the details of the -C option and the reference manual of RNAlib.
Since version 2.2 the ViennaRNA Package distinguishes hard and soft constraints. As a consequence,
structure predictions are easily amenable to a versatile set of constraints, such as maximal base pair
span, incorporation of SHAPE reactivity data, and RNA-ligand binding to hairpin, or interior loop motifs.
Restricting the maximal span of a base pair
A convenience commandline option allows you to easily limit the distance (j - i + 1) between two
nucleotides i and j that form a basepair. For instance a limit of 600nt can be accomplished using:
$ RNAfold --maxBPspan 600
Guide structure prediction with SHAPE reactivity data
Use SHAPE reactivity data to guide secondary structure prediction:
$ RNAfold --shape=reactivities.dat < sequence.fa
where the file reactivities.dat is a two column text file with sequence positions (1-based) and
normalized reactivity values (usually between 0 and 2. Missing values may be left out, or assigned a
negative score:
$ cat reactivities.dat
9 -999 # No reactivity information
10 -999
11 0.042816 # normalized SHAPE reactivity
12 0 # also a valid SHAPE reactivity
15 0.15027 # Missing data for pos. 13-14
...
42 0.16201
Note, that RNAfold will only process the first sequence in the input file, when provided with SHAPE
reactivity data!
Complex structure constraints and grammar extensions
Structure constraints beyond those that can be expressed with a pseudo-dot bracket notation may be
provided in a so-called command file:
$ RNAfold --commands=constraints.txt < sequence.fa
The command file syntax is a generalization of constraints as used in UNAfold/mfold. Each line starts
with a one or two letter command followed by command parameters. For structure constraints, this amounts
to a single command character followed by three or four numbers. In addition, optional auxiliary modifier
characters may be used to limit the constraint to specific loop types. For base pair specific
constraints, we currently distinguish pairs in exterior loops (E), closing pairs of hairpin loops (H),
closing (I) and enclosed (i) pairs of interior loops, and closing (M) and enclosed (m) pairs of
multibranch loops. Nucleotide-wise constraints may be limited to their loop context using the
corresponding uppercase characters. The default is to apply a constraint to all (A) loop types.
Furthermore, pairing constraints for single nucleotides may be limited to upstream (U), or downstream (D)
orientation. The command file specification is as follows:
F i 0 k [TYPE] [ORIENTATION] # Force nucleotides i...i+k-1 to be paired
F i j k [TYPE] # Force helix of size k starting with (i,j) to be formed
P i 0 k [TYPE] # Prohibit nucleotides i...i+k-1 to be paired
P i j k [TYPE] # Prohibit pairs (i,j),...,(i+k-1,j-k+1)
P i-j k-l [TYPE] # Prohibit pairing between two ranges
C i 0 k [TYPE] # Nucleotides i,...,i+k-1 must appear in context TYPE
C i j k # Remove pairs conflicting with (i,j),...,(i+k-1,j-k+1)
E i 0 k e # Add pseudo-energy e to nucleotides i...i+k-1
E i j k e # Add pseudo-energy e to pairs (i,j),...,(i+k-1,j-k+1)
UD m e [LOOP] # Add ligand binding to unstructured domains with motif
# m and binding free energy e
# [LOOP] = { E, H, I, M, A }
# [TYPE] = [LOOP] + { i, m }
# [ORIENTATION] = { U, D }
Again, RNAfold by default only processes the first sequence in the input sequence when provided with
constraints in a command file. To apply the exact same constraints to each of the input sequences in a
multi FASTA file, use the batch mode commandline option:
$ RNAfold --constraint=constraints.txt --batch < sequences.fa
Ligand binding contributions to specific hairpin/interior loop motifs
A convenience function allows one to specify a hairping/interior loop motif where a ligand is binding
with a particular binding free energy dG. Here is an example that adds a theophylline binding motif.
Free energy contribution of this motif of dG=-9.22kcal/mol is derived from k_d=0.32umol/l, taken from
Jenison et al. 1994. Although the structure motif consists of a symmetric interior loop of size 6,
followed by a small helix of 3 basepairs, and a bulge of 3 nucleotides, the entire structure can still be
represented by one interior loop. See the below mofif description where the '&' character splits the
motif into a 5' and a 3' part. The first line gives the sequences motif, the second line shows the actual
structure motif of the aptamer pocket, and the third line is the interior loop motif that fully
encapsulates the theophylline aptamer:
GAUACCAG&CCCUUGGCAGC
(...((((&)...)))...)
(......(&).........)
To use the above information in the folding recursions of RNAfold, one only needs to provide the motif
itself, and binding free energy:
$ RNAfold --motif="GAUACCAG&CCCUUGGCAGC,(...((((&)...)))...),-9.22" < sequences.fa
Adding the --verbose option to the above call of RNAfold also prints the sequence position of each motif
found in the MFE structure. In case interior-loop like motifs are provided, two intervals are printed
denoting the 5' and 3' part, respectively.
Ligand binding contributions to unpaired segments of the RNA structure
The extension of the RNA folding grammar with unstructured domains allows for an easy incorporation of
ligands that bind to unpaired stretches of an RNA structure. To model such interactions only two
parameters are required: (i) a sequence motif in IUPAC notation that specifies where the ligand binds to,
and (ii) a binding free energy that can be derived from the association/dissociation constant of the
ligand. With these two parameters in hand, the modification of RNAfold to include the competition of
regular intramolecular base pairing and ligand interaction is as easy as writing a simple command file of
the form:
UD m e [LOOP]
where m is the motif string in upper-case IUPAC notation, and e the binding free energy in kcal/mol and
optional loop type restriction [LOOP]. See also the command file specification as defined above.
For instance, having a protein with a 4-nucleotide footprint binding 'AAAA', a binding free energy e =
-5.0 kcal/mol, and a binding restriction to exterior- and multibranch loops results in a command file:
$ cat commands.txt
UD AAAA -5.0 ME
and the corresponding call to RNAfold to compute MFE and equilibrium probabilities becomes:
$ RNAfold --commands=commands.txt -p < sequence.fa
The resulting MFE plot will be annotated to display the binding site(s) of the ligand, and the base pair
probability dot-plot is extended to include the probability that a particular nucleotide is bound by the
ligand.
AUTHOR
Ivo L Hofacker, Walter Fontana, Sebastian Bonhoeffer, Peter F Stadler, Ronny Lorenz
REPORTING BUGS
If in doubt our program is right, nature is at fault. Comments should be sent to rna@tbi.univie.ac.at.
RNAfold 2.5.1 April 2024 RNAFOLD(1)