Provided by: libbio-perl-perl_1.7.8-1_all 

NAME
Bio::SeqFeature::Amplicon - Amplicon feature
SYNOPSIS
# Amplicon with explicit sequence use Bio::SeqFeature::Amplicon; my $amplicon = Bio::SeqFeature::Amplicon->new( -seq => $seq_object, -fwd_primer => $primer_object_1, -rev_primer => $primer_object_2, ); # Amplicon with implicit sequence use Bio::Seq; my $template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' ); $amplicon = Bio::SeqFeature::Amplicon->new( -start => 6, -end => 15, ); $template->add_SeqFeature($amplicon); print "Amplicon start : ".$amplicon->start."\n"; print "Amplicon end : ".$amplicon->end."\n"; print "Amplicon sequence: ".$amplicon->seq->seq."\n"; # Amplicon sequence should be 'CCCCCGGGGG'
DESCRIPTION
Bio::SeqFeature::Amplicon extends Bio::SeqFeature::Subseq to represent an amplicon sequence and optional primer sequences.
FEEDBACK
Mailing Lists User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated. bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists Support Please direct usage questions or support issues to the mailing list: bioperl-l@bioperl.org rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible. Reporting Bugs Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web: https://github.com/bioperl/bioperl-live/issues
AUTHOR
Florent Angly <florent.angly@gmail.com>
APPENDIX
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ new Title : new() Usage : my $amplicon = Bio::SeqFeature::Amplicon( -seq => $seq_object ); Function: Instantiate a new Bio::SeqFeature::Amplicon object Args : -seq , the sequence object or sequence string of the amplicon (optional) -fwd_primer , a Bio::SeqFeature primer object with specified location on amplicon (optional) -rev_primer , a Bio::SeqFeature primer object with specified location on amplicon (optional) Returns : A Bio::SeqFeature::Amplicon object fwd_primer Title : fwd_primer Usage : my $primer = $feat->fwd_primer(); Function: Get or set the forward primer. When setting it, the primary tag 'fwd_primer' is added to the primer and its start, stop and strand attributes are set if needed, assuming that the forward primer is at the beginning of the amplicon and the reverse primer at the end. Args : A Bio::SeqFeature::Primer object (optional) Returns : A Bio::SeqFeature::Primer object rev_primer Title : rev_primer Usage : my $primer = $feat->rev_primer(); Function: Get or set the reverse primer. When setting it, the primary tag 'rev_primer' is added to the primer. Args : A Bio::SeqFeature::Primer object (optional) Returns : A Bio::SeqFeature::Primer object perl v5.32.1 2021-08-15 Bio::SeqFeature::Amplicon(3pm)